Student’s Name
Final exam BIOL 302 Bacteria, Viruses, and Health Summer
2016
Part A Multiple Choice: (1 point each)
1. In the lab you use
the gram staining procedure, a differential staining technique, as a first step
in identifying the type of bacteria on a slide. After you carefully perform the
staining procedure, you look at the cells under the microscope and see purple
rod shaped cells. This result indicates that
a. the cells
have a thick peptidoglycan layer as part of the physical structure of the cell
wall and are gram-positive bacilli.
b. the cells
have a thin peptidoglycan layer as part of the physical structure of the cell
wall and are gram-positive bacilli.
c. the
cells have a thin peptidoglycan layer as part of the physical structure of the
cell wall and are gram-negative cocci.
d. the cells
have a thin peptidoglycan layer as part of the physical structure of the cell
wall and are gram-negative bacilli.
e. the cells
have a thick peptidoglycan layer as part of the physical structure of the cell
wall and are gram-negative bacilli.
Answer a. the cells have a thick peptidoglycan layer as part
of the physical structure of the cell wall and are gram-positive bacilli.
2. Which of
the following infectious diseases has (or have) been eradicated in the world?
a. polio
b. measles
c. smallpox
d. whooping cough
e. all of the above
Answer c. smallpox
3. Which of the followings is a characteristic of prions
that is unique from other known pathogenic microbes?
a. They lack the characteristics of a classic cell.
b. They can be transmitted from animals to man.
c. They cause permanent damage to the host.
d. They are made entirely of protein.
Answer b. They can be transmitted from animals to man.
4. The first
microorganism demonstrated to satisfy Koch's postulates (in the late 19th
century) was
a. Mycobacterium tuberculosis
b. Bacillus anthracis
c. Mycobacterium leprae
d. Vibrio cholera
Answer a. Mycobacterium tuberculosis
5. Which of the following is a characteristic of the
adaptive immune response and not of the innate immune response?
a. Physical and chemical barriers
b. Clonal expansions of activated B cells
c. Inflammatory mediators
d. Phagocytosis
Answer b. Clonal expansions of activated B cells
6. What does each
codon in messenger RNA (mRNA) specify?
a. a nucleotide
b. an enzyme
c. an amino acid
d. a promoter
Answer c. an amino acid
7. Antigens are
a. specific.
b. proteins or polysaccharides (complex sugars).
c. recognized as foreign by the body's immune system.
d. all of the above.
Answer d
8. Oncogenes are genes that
a. the virus utilizes to replicate itself.
b. transform normal cells to cancer cells.
c. promote genetic recombination in bacteria.
d. influence ongoing protein production.
Answer b. transform normal cells to cancer cells.
9. Genes A, B, and C are three structural genes of an operon
and fall in that order within the operon. A mutation occurs in Gene A that
halts transcription early in the gene. What effect will this have on the levels
of proteins produced by Genes A, B, and C?
a. No proteins coded by genes A, B, and C will be produced.
b. Proteins coded by genes B and C, but not gene A, will be
produced
c. Proteins coded by genes A, B, and C will be produced.
d. Only proteins coded by gene A will be produced.
Answer a. No proteins coded by genes A, B, and C will be
produced.
10. Plasmids
a. replicate with the bacterial chromosome.
b. may contain antibiotic resistance genes.
c. are as large as the bacterial chromosome.
d. contain genes essential for growth.
Answer b. may contain antibiotic resistance genes.
11. Interferons are
an important part of the host defense against viral infections. Their principal
mode of action is that
a. they trigger the synthesis of one or more cellular
proteins that inhibit viral replication.
b. they are present in the serum of healthy individuals and
act as viral surveillance factors.
c. they coat viral particles and block their attachment to
cells.
d. they protect the death of a viral-infected cell.
Answer a. they trigger the synthesis of one or more cellular
proteins that inhibit viral replication.
12. The form of
genetic exchange by which donor DNA is introduced into a recipient bacterial
cell by a bacterial virus is
a. transformation.
b. conjugation.
c. transduction.
d. transfection.
e. vertical
transfer.
Answer c. transduction.
13. Viruses usually
initiate infection by first interacting with receptors on the surface of cells.
Which of the following statements is most accurate about cellular receptors for
viruses?
a. Cellular receptors for viruses have no known function.
b. All viruses within a given family use the same cellular
receptor.
c. All cells in a susceptible host will express the viral
receptor.
d. Successful infection of a cell by a virus may involve the
interaction with more than one type of receptor.
Answer d. Successful infection of a cell by a virus may
involve the interaction with more than one type of receptor.
14. What was
Edward Jenner's contribution to microbiology?
a. He
discovered how to create a vaccine to trigger the body's immune system to
develop antibodies that fight microbes.
b. He
proposed the germ theory.
c. He
developed the compound microscope.
d. He
developed the binomial nomenclature system.
Answer a. He discovered how to create a vaccine to trigger
the body's immune system to develop antibodies that fight microbes.
15. The production of RNA using DNA as a template is known
as
a. transduction.
b. transformation.
c. transcription
d. translation.
Answer c. transcription
16. Humoral
immunity involves the secretion of antibodies from
a. T cells.
b. macrophages.
c. neutrophils.
d. plasma
cells.
Answer d. plasma cells
17. Which of
the following describes the correct relationship between the major structures
of a virus?
a. The
envelope encloses the genome of the virus.
b. The
capsid encloses the genome of the virus.
c. The
capsid encloses the envelope of the virus.
d. The
genome encloses the capsid of the virus.
Answer The capsid encloses the genome of the virus.
18. Immunity
that results when a person is vaccinated against the 2009-H1N1 influenza is
a. active
artificially acquired immunity.
b. passive
naturally acquired immunity.
c. active
naturally acquired immunity.
d. passive
artificially acquired immunity.
Answer a. active artificially acquired immunity.
19. What are some benefits of our microbiome?
a. It can supply
essential nutrients.
b. It can
aid in preventing the colonization of pathogens.
c. It can
ensure proper functioning of the host immune systems
d. It can
aid in food digestion.
e. All of
the above
Answer e. All of the above
14. Protein
toxins that may interfere with host cell function or damage host cell membranes
and are usually secreted by living bacteria are called
a. adhesion
factors.
b. antibodies.
c. exotoxins
d. endotoxins.
Answer c. exotoxins
Part B. Short Answer (5 points each)
21. Explain
how genetic information is transferred from DNA to RNA to proteins. Include the
terms DNA replication, transcription, translation, the principal events and
enzymes. Use the following DNA molecule to illustrate each stage.
3' TACTAGCCACATCTACCGATC 5' template strand
5' ATGATCGGTGTAGATGGCTAG 3' Coding (“inactive” strand)
22. Explain
why the structure is or is not each of the following: a human T cell, a virus,
a bacterial cell, a yeast cell.
23. Describe
the difference between an emerging and a re-emerging disease and give a recent
example of a viral or a bacterial infection of each and explain the reason for
that classification.
24. Name the four
types of acquired immunity and describe the mechanisms by which a person
acquires the immunity (“how it is conferred”). In a table describe the
following characteristics for each them: type of immunizing agent (antibodies
or antigen), relative time for immunity to appear, relative time the immunity
lasts, and the source of antibodies (for example, self or non-self) that act
against a pathogen or other antigen
25. Which of
the following three hypotheses is most likely?
26. Describe
how the first and second lines of defense of your innate immune system can
protect you from influenza-A infection.
27. List the
stages of the viral life cycle and briefly describe the principal events in the
stages of the life cycle of a virus in the Retroviridae family and explain what
makes viruses in that family difficult to eliminate from the host. Name a virus
in that family.
28. Explain
why a secondary antibody response to an antigen may prevent a bacterial or
viral disease when the primary adaptive immune response to that antigen did not
protect the person from the disease. Be specific about the type of cells and
products involved in the responses.
29. Read the
following Science Daily article: NIH/National Institute of Allergy and
Infectious Diseases. (2016, March 16). Experimental dengue vaccine protects all
recipients in virus challenge study. ScienceDaily. Retrieved July 17, 2016 from
www.sciencedaily.com/releases/2016/03/160316151106.htm. Write a brief summary
(one paragraph) about the study that answers the following questions.
30. Genetic
reassortment is a mechanism by which new influenza virus subtypes are
produced. Using a virus with a
three-segmented RNA genome as an example, describe and illustrate this process
and include an example of genetic reassortment that resulted in a major change
in the genome (antigenic shift ) creating a new influenza A subtype. Show all
possible outcomes.
